16/10/2009

Hướng dẫn sử dụng Primer3 để thiết kế mồi cho phản ứng PCR (Phần 1)

By Tuan Tran, Department of Microbiology, VNU University of Science (Vietnam).


Chào các bạn, bài viết này giúp các bạn bước đầu làm quen với chương trình Primer3. Trong Phần 2 hướng dẫn sử dụng chương trình này, các bạn sẽ tìm thấy nhiều thông tin chi tiết hơn. 

Link cho Phần 2: ''http://sinhhocphantu.blogspot.de/2013/05/huong-dan-su-dung-primer3-e-thiet-ke.html''


Primer3 là chương trình được sử dụng phổ biến để thiết kế mồi (primer) cho phản ứng PCR (Polymerase Chain Reaction).  Đây là chương trình mã nguồn mở, do Steve Rozen and Helen Skaletsky phát triển tại Whitehead Institute và Howard Hughes Medical Institute, USA.

Vì PCR được sử dụng cho nhiều mục đích khác nhau nên Primer3 có nhiều các thông số mà bạn có thể điều chỉnh để tạo ra những primer tốt nhất cho mục đích của bạn. 

Sau đây là giao diện của chương trình Primer3 (http://frodo.wi.mit.edu/primer3/input.htm)



1. PCR thông thường

Trong phần này các bạn làm quen với chương trình Primer3 một cách đơn giản nhất thông qua ví dụ nấm sợi Verticillium longisporum gây bệnh trên cây trồng thuộc họ cải Brassicaceae được chuyển gene phát huỳnh quang eGFP (enhanced green fluorescent protein) thông qua vi khuẩn Agrobacterium tumefaciens. Khi nấm đã có khả năng phát sáng huỳnh quang dưới kính hiển vi, bạn muốn thiết kế cặp mồi (primer pair) đặc hiệu cho gene eGFP để xác nhận sự có mặt của gene này trong genome của nấm.



Nấm Verticillium longisporum được chuyển gene eGFP

Bạn dán trình tự của gene eGFP (720 bp) sau đây vào khung cửa sổ chính của chương trình Primer3:
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA



Sau đó thay đổi một vài thông số như được chỉ ra trong khung màu đỏ để có được cặp mồi tối ưu.




Nhấp chuột vào Pick Primers (mũi tên đỏ) để nhận cặp primer tối ưu nhất (mồi bên trái và mồi bên phải) mà chương trình đề nghị. 

Kết quả là bạn sẽ nhận được 1 cặp mồi chính trong khung màu đỏ (ở đầu cửa sổ) và 1 cặp mồi bổ sung (ở cuối cửa sổ)



Đối với PCR, kích thước sản phẩm nên lớn hơn 250 bp để phân biệt với band của DNA primer dimer (nếu có) và dễ dàng hơn khi đối chiếu với thang DNA chuẩn (DNA ladder) trên bản gel agarose sau điện di. 


Như vậy bạn có thể sử dụng 1 trong 2 cặp mồi sau đây để thực hiện phản ứng PCR đặc hiệu cho gene eGFP:

Cặp 1:
Mồi xuôi (forward primer):    eGFP-FW: ACGTAAACGGCCACAAGTTC
Mồi ngược (reverse primer): eGFP-RV: TGCTCAGGTAGTGGTTGTCG

Cặp 2:
Mồi xuôi (forward primer):    eGFP-FW: GACGTAAACGGCCACAAGTT
Mồi ngược (reverse primer): eGFP-RV: TGCTCAGGTAGTGGTTGTCG


2. Quantitative real-time PCR (qPCR)

Mục đích:

- Định lượng mức độ biểu hiện của một gene trong mẫu nghiên cứu thông qua cDNA.
- Định lượng vi sinh vật đặc hiệu có mặt trong mẫu nghiên cứu thông qua genomic DNA (gDNA).
Định lượng số lượng bản sao (copy) của một gene có mặt trong genome của sinh vật.
...

Các thông số cơ bản để thiết kế qPCR primers với Primer3 
(xem hình minh họa):

- Kích thước sản phẩm (Product Size Ranges): 120-200 (bp)
- Số lượng cặp mồi (Number To Return): 1
- Kích thước mồi (Primer Size): 20-24 (bp)
- Nhiệt độ melting mồi (Primer Tm): 60-64
- GC% của mồi (Primer GC%): 40-60
- Số nucleotide tự bổ trợ tối đa (Max Self Complementarity): 3 hoặc 4
- Số nucleotide liên tiếp giống hệt nhau tối đa (Max Poly-X): 4 





Chúc các bạn thành công.


Nếu bạn đăng lại bài viết này trên một website khác, vui lòng trích dẫn sinhhocphantu.blogspot.com. Thank you.


1 nhận xét:

CHASTE R.F. nói...

Cảm ơn tác giả, bài viết rất hữu ích.